Details for Capsella Locus Carubv10015945m

Position : scaf_3 ( 5`- 9223681 .. 9224487 -3` )
Annotation :
External links : CoGe
PGDD synteny : Carubv10015945m

Protein [Map View]
MMNISLKLSLLIFILVITSDIGSEARELIGANNEFEVPAESSNYAGTTRTLMQDPLQGQTCKADADCLKCSTGFATFF*

DNA
ATGATGAATATTTCTTTGAAGCTCTCACTCTTGATTTTCATTTTGGTCATCACATCTGATATTGGATCAGAAGCAAGGGA
GCTAATAGGAGCTAACAATGAATTCGAAGTTCCCGCCGAAAGTTCAAACTACGCCGGTACCACCAGGACCTTGATGCAAG
ACCCGCTCCAAGGTCAAACTTGCAAAGCTGATGCTGATTGCTTAAAATGTTCCACAGGATTTGCAACATTTTTTTAG