Details for Capsella Locus Carubv10015287m

Position : scaf_3 ( 5`- 1701513 .. 1701722 -3` )
Annotation :
External links : CoGe
PGDD synteny : Carubv10015287m

Protein [Map View]
GFIVEFVEVVRGVYTAEYRSKSYITFMAREKPDGPLVEYQAKVWCTVVQHENYPILCRPARPAKPSNQN*

DNA
GGTTTCATTGTGGAGTTTGTGGAAGTGGTGCGAGGTGTATATACAGCAGAATATAGATCAAAGTCGTACATTACATTTAT
GGCTAGGGAGAAACCTGATGGACCTCTCGTTGAGTATCAAGCTAAGGTTTGGTGTACTGTCGTTCAACACGAGAACTATC
CCATCCTCTGTAGACCGGCTCGTCCGGCAAAGCCTTCAAACCAAAACTAG