Details for Capsella Locus Carubv10015096m

Position : scaf_3 ( 5`- 6384991 .. 6385212 -3` )
Annotation :
External links : CoGe
PGDD synteny : Carubv10015096m

Protein [Map View]
MARHLEGVMSMATTTHFDASYLFHVVFLALIGCCVLSAMLFSCSDGVSDNRRSSANTTGGGGCGGGGCGGCGG*

DNA
ATGGCGAGACACTTAGAAGGTGTAATGAGCATGGCTACTACAACACATTTCGATGCTAGCTACCTCTTTCATGTTGTGTT
CTTGGCTCTCATCGGCTGTTGTGTCCTCTCGGCTATGTTATTCTCCTGCTCCGACGGAGTTTCCGACAACCGACGCTCTT
CGGCAAACACTACCGGTGGCGGAGGTTGTGGGGGTGGCGGTTGCGGTGGTTGTGGAGGTTGA