Details for Chinese cabbage Locus Brara.G03610

Position : A07 ( 5`- 26810767 .. 26811917 -3` )
Annotation :
External links : CoGe
PGDD synteny : Brara.G03610

Protein [Map View]
MDANNAFDSDLIHAIFKHIWARRFRERERSDAIDATDAEVALGTSKKNRLASANANALKLSCELLKSFVSEAVQRAAIIA
EAEGMDKIEASHLERILPQLLLDF*

DNA
ATGGACGCCAACAATGCTTTCGATTCTGATCTGATTCACGCCATCTTCAAGCACATTTGGGCGCGAAGATTTCGCGAAAG
AGAGAGGAGTGATGCCATTGATGCTACAGACGCTGAGGTTGCGTTGGGAACATCCAAGAAGAACAGACTTGCTTCTGCGA
ATGCAAATGCTCTGAAACTGAGCTGTGAGCTTCTCAAGAGTTTTGTCTCAGAGGCTGTGCAGCGCGCGGCTATAATTGCT
GAAGCTGAGGGGATGGATAAGATCGAAGCGAGTCATTTGGAGAGAATTCTTCCTCAGCTTCTTTTAGACTTTTAA