Details for Chinese cabbage Locus Brara.A02646

Position : A01 ( 5`- 22177229 .. 22178635 -3` )
Annotation :
External links : CoGe
PGDD synteny : Brara.A02646

Protein [Map View]
MGRLVNGATLLALLCFHVFAVNVTARNGVSSSKDEEEKTLIGGGKGGGFGGGFGGGSGGGIGAGGGFGGGGGAGGGGGGF
GGGQGGGVGVGGGFGKGGGVGGGKGGGIGGGGGFGGGGGFGKGGGIGGGIGKGGGFGGGGGFGKGGGFGGGGGFGKGGGF
GGGGFGGGGGGGGGGGGGIGHH*

DNA
ATGGGGCGTCTAGTTAATGGAGCTACTCTATTGGCTTTATTATGTTTTCATGTTTTCGCTGTGAATGTTACTGCCAGAAA
TGGTGTGAGTTCTAGCAAAGATGAAGAGGAAAAAACGTTAATTGGAGGCGGCAAGGGTGGTGGCTTTGGCGGTGGTTTTG
GAGGAGGATCTGGCGGTGGAATAGGAGCAGGCGGTGGTTTTGGAGGCGGCGGTGGCGCTGGTGGAGGTGGAGGAGGTTTT
GGTGGTGGACAGGGGGGAGGTGTCGGAGTCGGTGGTGGCTTTGGTAAGGGTGGTGGGGTTGGCGGTGGCAAAGGCGGAGG
CATTGGAGGTGGAGGAGGCTTTGGCGGTGGAGGTGGATTTGGCAAAGGCGGGGGAATCGGTGGTGGAATAGGCAAAGGCG
GAGGATTTGGTGGCGGGGGTGGATTTGGGAAAGGAGGGGGTTTTGGTGGAGGTGGTGGATTTGGTAAGGGCGGAGGATTT
GGCGGTGGAGGCTTTGGAGGCGGAGGTGGAGGTGGAGGTGGAGGGGGTGGTGGAATCGGACATCACTAA