Details for Kale Locus Bo5g132270

Position : C5 ( 5`- 40939526 .. 40940171 -3` )
Annotation :
External links : CoGe
PGDD synteny : Bo5g132270

Protein [Map View]
MGSNTPPTRESVTDRNKTSILMQVDAFPREGCMPEFNVSYKPQGYDWKREYAMRSLQIEALLDQAVNKISGGERQRVFIT
LCLGKPADIYLIDEPSAHLDSSNISHLHRS*

DNA
ATGGGTTCTAACACACCTCCCACTAGAGAATCTGTGACTGATAGGAATAAAACTAGTATCCTCATGCAGGTAGATGCATT
CCCACGTGAAGGGTGTATGCCAGAGTTTAATGTGTCGTACAAACCGCAAGGATATGATTGGAAGCGTGAATATGCAATGA
GATCGCTTCAGATTGAAGCGTTGTTGGATCAAGCGGTAAATAAAATTTCAGGTGGAGAGAGGCAGAGGGTTTTCATTACT
TTATGCCTCGGGAAGCCAGCAGATATCTATCTGATTGATGAGCCAAGTGCGCATCTAGACTCAAGCAACATATCACATCT
TCATAGGTCATAA