Details for Arabidopsis Locus AT3G24770

Position : Chr3 ( 5`- 9046533 .. 9047463 -3` )
Annotation :
External links : SALK TAIR PlantTribes CoGe
PGDD synteny : AT3G24770

Protein [Map View]
MATSNDQTNTKSSHSRTLLLLFIFLSLLLFSSLTIPMTRHQSTSMVAPFKRVLLESSVPASSTMDLRPKASTRRSRTSRR
REFGNDAHEVPSGPNPISN*

DNA
ATGGCAACATCAAATGACCAAACCAATACTAAATCATCACATTCTCGTACTCTTCTCCTTCTCTTCATCTTCTTATCCCT
CCTTCTCTTCAGTAGCCTTACAATCCCCATGACTCGTCATCAGTCCACATCTATGGTTGCTCCCTTCAAGAGGGTTCTCC
TCGAATCTTCAGTTCCAGCTTCATCAACAATGGATCTACGTCCAAAGGCTAGCACACGACGCAGCCGCACTTCTAGAAGG
AGAGAGTTTGGAAATGATGCTCATGAGGTTCCTAGTGGTCCAAACCCTATTTCCAACTAG