Details for Arabidopsis Locus AT3G23450

Position : Chr3 ( 5`- 8410433 .. 8412193 -3` )
Annotation :
External links : SALK TAIR PlantTribes CoGe
PGDD synteny : AT3G23450

Protein [Map View]
MGRLVSGATLLALLCFHVFVVNVVARDVSSGRDEDEKTLVGGGKGGGFGGGFGGGAGGGVGGGAGGGFGGGAGGGFGGGG
GGGGGGGGGGGGGFGGGGGFGGGHGGGVGGGVGGGHGGGVGGGFGKGGGIGGGIGKGGGVGGGIGKGGGIGGGIGKGGGV
GGGIGKGGGIGGGIGKGGGIGGGIGKGGGIGGGIGKGGGIGGGIGKGGGVGGGFGKGGGVGGGIGKGGGVGGGFGKGGGV
GGGIGKGGGIGGGIGKGGGIGGGIGKGGGIGGGIGKGGGIGGGIGKGGGIGGGIGKGGGIGGGIGKGGGIGGGIGKGGGI
GGGGGFGKGGGIGGGIGKGGGIGGGGGFGKGGGIGGGIGKGGGIGGGFGKGGGIGGGIGGGGGFGGGGGFGKGGGIGGGI
GKGGGFGGGGGFGKGGGIGGGGGFGKGGGFGGGGFGGGGGGGGGGGGGIGHH*

DNA
ATGGGGCGTCTCGTTAGTGGTGCTACTCTTTTGGCTTTGTTATGTTTCCATGTTTTTGTGGTGAATGTTGTAGCGAGAGA
TGTGAGCTCGGGAAGAGATGAGGATGAGAAGACGTTAGTTGGAGGAGGAAAGGGTGGTGGCTTTGGCGGTGGATTTGGAG
GAGGAGCCGGTGGTGGAGTTGGAGGAGGAGCCGGTGGTGGCTTTGGAGGAGGAGCAGGCGGTGGGTTTGGAGGAGGTGGT
GGTGGAGGTGGAGGTGGAGGTGGTGGTGGTGGAGGAGGCTTTGGTGGTGGAGGAGGTTTTGGTGGTGGACATGGTGGAGG
TGTTGGTGGTGGAGTTGGCGGTGGACATGGCGGAGGAGTCGGTGGTGGGTTTGGAAAAGGTGGAGGGATCGGAGGTGGAA
TTGGAAAAGGTGGAGGAGTTGGCGGTGGCATCGGTAAAGGCGGCGGCATTGGTGGTGGAATAGGCAAAGGTGGAGGAGTT
GGCGGCGGTATCGGTAAAGGTGGAGGTATCGGTGGCGGGATCGGCAAGGGCGGAGGTATCGGTGGCGGGATCGGCAAGGG
TGGAGGTATCGGTGGCGGGATCGGCAAGGGTGGAGGTATTGGTGGTGGGATCGGCAAAGGTGGAGGAGTTGGCGGTGGTT
TTGGTAAAGGCGGAGGTGTTGGCGGTGGAATTGGCAAAGGCGGAGGAGTTGGCGGTGGTTTCGGCAAAGGCGGAGGAGTT
GGTGGTGGAATTGGCAAAGGTGGAGGTATTGGCGGTGGCATTGGCAAAGGTGGTGGAATTGGTGGGGGCATTGGCAAAGG
CGGAGGCATTGGTGGGGGAATAGGTAAAGGCGGTGGAATTGGTGGCGGCATTGGCAAAGGCGGAGGGATTGGTGGTGGAA
TAGGCAAAGGCGGTGGAATTGGTGGCGGCATTGGCAAAGGCGGGGGCATTGGCGGCGGAATTGGCAAAGGCGGAGGCATT
GGTGGTGGAGGTGGATTTGGTAAGGGTGGAGGCATTGGTGGTGGTATTGGTAAAGGTGGGGGTATTGGCGGAGGAGGTGG
ATTTGGTAAGGGTGGAGGCATTGGAGGCGGTATTGGCAAAGGCGGAGGCATTGGGGGCGGTTTCGGCAAAGGTGGAGGCA
TTGGTGGTGGCATTGGAGGTGGAGGAGGCTTTGGTGGAGGAGGTGGATTTGGAAAAGGTGGAGGAATCGGTGGTGGAATA
GGCAAAGGAGGAGGTTTCGGCGGAGGAGGTGGATTTGGGAAAGGTGGAGGTATTGGTGGAGGAGGTGGATTTGGTAAGGG
CGGAGGATTTGGCGGTGGAGGCTTCGGAGGTGGTGGCGGAGGTGGAGGCGGAGGAGGTGGCGGAATCGGACACCACTAA