Details for Arabidopsis Locus AT3G18250

Position : Chr3 ( 5`- 6258067 .. 6258417 -3` )
Annotation :
External links : SALK TAIR PlantTribes CoGe
PGDD synteny : AT3G18250

Protein [Map View]
MARHLLEDVMSMATTTTHFDASYLFHVVFLAVIGCCILSALLFSCADGVSDNRATSGTSTGGGGCGGAGCGGGCGG*

DNA
ATGGCGAGACACTTATTAGAAGATGTAATGAGCATGGCCACCACAACAACACATTTCGATGCTAGTTACCTGTTTCATGT
TGTGTTCCTGGCTGTGATCGGTTGTTGTATCCTCTCCGCTCTGTTATTCTCTTGTGCCGACGGAGTCTCCGACAACAGAG
CCACTTCAGGCACCTCTACCGGTGGCGGAGGTTGTGGCGGTGCCGGTTGCGGTGGTGGTTGTGGAGGTTGA