Details for Arabidopsis Locus AT1G78790

Position : Chr1 ( 5`- 29623529 .. 29625078 -3` )
Annotation :
External links : SALK TAIR PlantTribes CoGe
PGDD synteny : AT1G78790

Protein [Map View]
MDANNTFDSDLIHAIFKHIWARRFRERERSDAIDATEAEVALGTTKKNRLASANANALKLSCELLKSFVSEAVQRAAIIA
EAEGMEKIEATHLERILPQLLLDF*

DNA
ATGGACGCGAACAATACCTTCGATTCTGATCTGATTCACGCCATTTTTAAGCACATTTGGGCCCGAAGATTTCGCGAAAG
GGAGAGGAGCGATGCCATTGATGCTACGGAAGCTGAGGTTGCTCTGGGAACAACCAAGAAGAACAGACTTGCTTCTGCAA
ACGCAAATGCTTTAAAACTCAGCTGTGAACTTCTCAAGAGTTTTGTCTCAGAGGCTGTGCAGCGCGCTGCTATAATCGCT
GAAGCTGAGGGAATGGAAAAGATTGAAGCTACTCATTTAGAGAGGATTCTTCCCCAGCTTCTTCTGGACTTTTAA