Details for Arabidopsis Locus AT1G75550

Position : Chr1 ( 5`- 28369437 .. 28369940 -3` )
Annotation :
External links : SALK TAIR PlantTribes CoGe
PGDD synteny : AT1G75550

Protein [Map View]
MKTISSLVVIFLLILIFQTNKLVSGHDRSNDQDTVKNNNNDENSTTTGVVVRDKKRSYNGGSGSYRWGWGGGGGGGGGGG
GGGGGGGGGGGGWGWGGGGGGGGWYKWGCGGGGKGKGREGRGEFVKREYAECKGRGKCSGKRLECPQHCGGLCFYDCLFL
CKPHCRR*

DNA
ATGAAGACAATTTCTTCATTGGTCGTTATCTTCCTCCTCATACTGATCTTTCAAACTAACAAACTAGTGAGTGGGCATGA
CCGTTCCAATGATCAAGACACGGTCAAGAACAACAACAATGATGAAAACAGCACAACTACGGGAGTAGTTGTCAGGGACA
AGAAAAGAAGTTATAATGGAGGAAGCGGAAGTTATAGATGGGGATGGGGTGGAGGCGGCGGAGGAGGAGGCGGGGGTGGA
GGAGGAGGAGGTGGCGGTGGCGGTGGAGGAGGAGGATGGGGATGGGGAGGAGGAGGAGGTGGTGGAGGATGGTACAAATG
GGGTTGTGGCGGCGGAGGAAAAGGAAAAGGGAGAGAAGGAAGAGGAGAGTTTGTGAAAAGAGAATATGCAGAGTGCAAAG
GAAGAGGAAAATGTTCAGGAAAGAGATTGGAATGTCCTCAACACTGTGGAGGTTTGTGTTTCTACGATTGTCTGTTTCTC
TGCAAACCTCATTGCCGTCGCTAG