Details for Lyrate rockcress Locus 16054495

Position : sca3 ( 5`- 7812807 .. 7812580 -3` )
Annotation :
External links : CoGe
PGDD synteny : 16054495

Protein [Map View]
MARHLLEDVMSMATTTTHFDASYLFHVVFLAVIGSCILSALLFSCADGASDNRATSGNSTGGGGCGGAGCGGGCG*

DNA
ATGGCGAGACACTTATTAGAAGATGTAATGAGCATGGCCACCACAACAACACATTTCGATGCTAGTTACCTGTTTCATGT
TGTCTTCTTGGCTGTGATTGGTTCTTGTATCCTCTCGGCTCTGTTATTCTCGTGTGCCGATGGAGCCTCCGACAACAGAG
CCACTTCCGGAAACTCTACCGGTGGCGGAGGTTGTGGCGGTGCAGGTTGCGGAGGTGGTTGTGGTTGA