Details for Lyrate rockcress Locus 16040686

Position : sca3 ( 5`- 4028634 .. 4028440 -3` )
Annotation : [B2G] 40s ribosomal protein s28-1
External links : CoGe
PGDD synteny : 16040686

Protein [Map View]
MDSQIKHAVVVKVMGRTGSRGQVTQVRVKFTDSDRYIMRNVKGPVREGDILTLLESEREARRLR*

DNA
ATGGATTCTCAGATCAAGCACGCTGTTGTAGTGAAAGTGATGGGAAGGACTGGGTCAAGGGGTCAAGTGACTCAGGTTAG
AGTGAAGTTCACTGACTCGGACCGTTACATCATGAGGAACGTCAAAGGACCAGTCAGAGAGGGAGATATTCTCACCCTGC
TCGAGTCTGAGAGAGAAGCTAGAAGACTGCGTTAA