Details for Lyrate rockcress Locus 16040611

Position : sca3 ( 5`- 10929777 .. 10929616 -3` )
Annotation :
External links : CoGe
PGDD synteny : 16040611

Protein [Map View]
MLVSNISGKLMSQLMEKMKERLEKMRRTVRQQRAKLHIIRICITMLLSSDDNS*

DNA
ATGTTGGTATCCAACATATCTGGAAAATTGATGAGTCAGTTGATGGAAAAGATGAAAGAGAGGCTGGAGAAGATGAGGAG
GACAGTGAGACAACAGAGAGCAAAGCTTCATATCATCAGAATTTGCATCACTATGCTTCTTTCTTCCGATGATAACTCTT
GA